Recently added:

    in total 0 items Total 0

    MiRNA Reverse Transcription Kit (includes gDNA removal reagent, stem-loop method)

    Specifically designed for short sequences, it gently removes genomic DNA without the need for EDTA.

    MiRNA Reverse Transcription Kit (includes gDNA removal reagent, stem-loop method), GOONIE, 500-113
    undefined
    +
    • undefined

    One-click copy of information

    Instruction manual

    Price:

    ¥ 1200

    Item Number:

    500-113

    • Specification
      • 100T
    Add to Cart Click to request a quote

    隐藏域元素占位

    • Product Description
    • Composition
    • Precautions
    • Item number: 500-113   

       

       

      Product Storage and Transportation: Storage temperature: Store at -20℃ Transportation temperature: dry ice transport or -20°C °C Ice pack transportation

       

       

      Product Overview:

      The miRNA Reverse Transcription Kit (including gDNA removal reagent, stem-loop method) is a reverse transcription kit that employs the stem-loop approach to synthesize first-strand cDNA from miRNA. The miRNA reverse transcriptase mix and buffer mix contain all the components required for the reverse transcription reaction—buffer, dNTPs, M-MLV reverse transcriptase, and RNase inhibitor—so you only need to add your RNA template and water (DEPC‑treated water or DNase/RNase‑free water) to initiate the reaction. The reverse transcriptase used in this product exhibits high stability, making it well suited for reverse transcription of miRNA samples.

      dsDNase, in combination with 10× dsDNase buffer, can eliminate residual genomic DNA contamination from RNA templates, ensuring more reliable downstream results. dsDNase specifically degrades double-stranded DNA—whether in dsDNA or in DNA–RNA hybrid duplexes—and is heat‑sensitive, rapidly and irreversibly inactivating at reverse transcription temperatures. Compared with the conventional approach of using DNase I to remove genomic DNA contamination, dsDNase does not require the addition of EDTA for inactivation, thereby saving experimental time and reducing inhibition of the reverse transcription reaction.

       

       

      Experimental Principle:

      MicroRNAs (miRNAs) are a class of evolutionarily conserved, small non-coding RNAs, typically 21–23 nucleotides in length, that regulate gene expression at the translational level. Because their sequences are only about 20 nucleotides long, the forward primer often spans the entire miRNA sequence and even includes additional flanking regions, leaving no suitable binding site for the reverse primer.

      Therefore, this kit employs the stem-loop method to synthesize the first strand of miRNA cDNA. The principle is to use a universal sequence that folds into a stem-loop structure as a primer to generate an extended first strand of miRNA‑specific cDNA. During subsequent amplification, the stem-loop structure unfolds at an appropriate temperature and binds to the corresponding amplification primers. Stem-loop primer design is described in   miRNA stem-loop primer and qPCR primer design> ), subsequently paired with our company SYBR Green Real-Time PCR Kit For its precise quantification, Figure 1 illustrates the schematic of reverse transcription and the detection principle.

           

       

      Figure 1. Schematic diagram of first-strand cDNA reverse transcription and detection of miRNA (stem-loop method)

      Product Composition:

      Item number

      Component

      Specification (100 reactions / 20 μL)

      500-113-1

      miRNA reverse transcription   Enzyme   Mix

      100  microliter

      500-113-2

      miRNA reverse transcription   buffer   Mix

      400 μL

      500-113-3

      dsDNase

      100 μl

      500-113-4

      10× dsDNase Buffer

      200 μL

       

      Instructions:

      • Pre-experiment preparation
      • PCR machine, centrifuge, mixer, 1.5 ml centrifuge tubes (RNase-free), PCR tubes (RNase-free)
      • Ice box, pipettes, and pipette tips (RNase-free)
      • Synthesis Stem-loop primer
      • Operating Procedure

      This kit can remove residual genomic DNA (gDNA) from RNA prior to the reverse transcription reaction, after which a stem-loop RT primer is used to synthesize cDNA from miRNA or total RNA. The reverse transcription process comprises two main steps: and . For the next step of quantitative PCR, it can be used in conjunction with our company’s relevant quantitative products.

      1. miRNA reverse transcription
      2. Remove genomic DNA

      Prepare the reaction mixture for genomic DNA removal according to Table 1, and perform the reaction following the protocol in Table 2. Gently pipette the reaction mixture to mix thoroughly, then briefly centrifuge; place at 37°C. °C Incubate for 2 min to remove genomic DNA contamination; 65 °C Incubate for 2 min to inactivate dsDNase, then place on ice.

      Table 1: Reaction System for Genomic DNA Removal

      Product Composition:

      Item number

      Component

      Specification (100 reactions / 20 μL)

      500-113-1

      miRNA reverse transcription   Enzyme   Mix

      100  microliter

      500-113-2

      miRNA reverse transcription   buffer   Mix

      400 μL

      500-113-3

      dsDNase

      100 μl

      500-113-4

      10× dsDNase Buffer

      200 μL

    • Precautions:

      1. Before use, gently invert each reagent several times to mix thoroughly, minimizing bubble formation, and centrifuge briefly prior to application. In particular, the miRNA reverse transcription Enzyme Mix and dsDNase are highly viscous; after mixing, they must be centrifuged.
      2. To prevent RNase contamination, keep the experimental area clean.
      3. Wear clean gloves and a mask during operation.
      4. All consumables used in the experiment, such as centrifuge tubes and pipette tips, must be RNase-free.
      5. miRNA stem-loop primer and qPCR primer design

      Stem-loop RT primer design: Based on a universal stem-loop structure, only the last six nucleotides need to be modified according to the specific miRNA sequence. The universal stem-loop sequence is: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAC.

      Taking miR‑1‑5p as an example, its sequence is CAUACUUCCUUACAUGCCCAUA. To construct the stem‑loop structure, simply append the reverse complement of the six nucleotides at the 3′ end of the miRNA to the universal stem‑loop sequence, yielding: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAC“TATGGG”.

      qPCR forward primer design: The upstream primer is designed using the portion of the miRNA sequence remaining after removing the last six nucleotides at the 3′ end. For example, the forward primer for miR‑1‑5p is (note that U should be replaced with T): CATACTTCCTTACATG. Check the primer’s Tm value; if it is too low, add a GC at the 5′ end to bring the Tm closer to 60°C (or incorporate LNA modifications to increase the annealing temperature). Accordingly, the forward primer for miR‑1‑5p can be designed as: GCCGCCATACTTCCTTACATG, with a Tm of 60.3°C. °C

      The downstream primer is universal, with the sequence GTGCAGGGTCCGAGGT.

      After primer design is complete, a preliminary assay is required to assess primer specificity. Typically, a melting curve analysis is performed to evaluate specificity; additionally, it is advisable to run the PCR product on an agarose gel to confirm that only a single band is present (given the very short product length, a gel with at least 3% agarose is recommended).

      1. miRNA detection internal reference primers

      Small nucleolar RNAs (snoRNAs) are approximately 60 to 300 nucleotides in length, highly expressed in a variety of tissues and cell types, and do not participate in miRNA‑mediated regulatory pathways; therefore, snoRNAs are excellent choices for internal controls. U6 is commonly used as an internal control for miRNA quantification.

      U6-F: GCTTCGGCAGCACATATACTAAAA;

      U6-R: CGCTTCACGAATTTGCGTGTCAT;

      Studies have confirmed that commonly used snoRNA assays include:

      Human: U6, RNU48, RNU44, U47;

      Mouse: U6, snoRNA-202, snoRNA-234, snoRNA-420;

      There is also a category of miRNAs that exhibit only minor variations across different experimental conditions:

      Human/mouse tissues: miR-152, -186, -25, -92, -26b, -16;

      Human/mouse cell lines: miR‑374, ‑16, ‑93, ‑186, ‑26b;

    Keywords

    Product Recommendations


    AF647 Mouse anti-mouse NK1.1 Antibody (PK136)

    Item Number:

    26-27014-1

    Application:

    FC

    Species reactivity:

    Mouse

    Host species:

    Mouse

    AF647 Rat Anti-mouse CD366 (Tim-3) Antibody (RMT3-23)

    Item Number:

    26-2336-1

    Application:

    FC

    Species reactivity:

    Mouse

    Host species:

    Rat

    AF647 Rat Anti-mouse CD226 (DNAM-1) Antibody (480.1)

    Item Number:

    26-2226-1

    Application:

    FC

    Species reactivity:

    Mouse

    Host species:

    Rat

    AF647 Rat Anti-mouse CD62L Antibody (MEL-14)

    Item Number:

    26-2062L-1

    Application:

    FC

    Species reactivity:

    Mouse

    Host species:

    Rat

    PE Mouse Anti-mouse CD49b Antibody (HMα2)

    Item Number:

    12-2049B-1

    Application:

    FC

    Species reactivity:

    Mouse

    Host species:

    Mouse

    AF647 Mouse Anti-mouse CD49b Antibody (HMα2)

    Item Number:

    26-2049B-1

    Application:

    FC

    Species reactivity:

    Mouse

    Host species:

    Mouse

    Submit your message

    If you are interested in our products, please provide your email address, and we will contact you as soon as possible. Thank you!

    Submit
    Image Name

    Apply for a Trial

    If you are interested in our products, please provide your email address, and we will contact you as soon as possible. Thank you!

    Please select a delivery dealer:

    Submit